So I have four lines of code
seq= 'ATGGAAGTTGGATGAAAGTGGAGGTAAAGAGAAGACGTTTGA'
OR_0 = re.findall(r'ATG(?:...){9,}?(?:TAA|TAG|TGA)',seq)  
Let me explain what I am attempting to do first . . . I'm sorry if this confusing but I am going to try my best to explain it.
So I'm looking for sequences that START with 'ATG' followed by units of 3 of any word char [e.g. 'GGG','GTT','TTA',etc] until it encounters either an 'TAA','TAG' or 'TGA' I also want them to be at least 30 characters long. . . hence the {9,}?
This works to some degree but if you notice in seq that there is ATG GAA GTT GGA TGA AAG TGG AGG TAA AGA GAA GAC GTT TGA
So in this case, it should be finding 'ATGGAAGTTGGATGA' if it starts with the first 'ATG' and goes until the next 'TAA','TAG' or 'TGA'
HOWEVER when you run the OR_0 line of code, it spits back out the entire seq string. I don't know how to make it only consider the first 'TAA','TAG' or 'TGA' followed by the first 'ATG'
If an 'ATG' is followed by another 'ATG' when read in units of 3 then that is alright, it should NOT start over but if it encounters a 'TAA','TAG' or 'TGA' when read in units of 3 it should stop.
My question, why is re.findall finding the longest sequence of 'ATG'xxx-xxx-['TAA','TAG' or 'TGA'] instead of the first occurrence of 'TAA','TAG' or 'TGA' after an ATG separated by word characters in units of 3 ?
Once again, I apologize if this is confusing but its messing with multiple data sets that I have based on this initial line of text and i'm trying to find out why
 
     
     
     
    