Finding unique strings of characters in each sequence

Question

I am trying to create a program that has multiple sequences of tRNA stored as a dictionary. I have set up my code to extract and store the sequences and the specific names associated with the sequences as:

class Unique():
    def __init__(self, seq = ''):
        for s in range(len(seq)):
            for e in range(s + 1, len(seq) + 1):
                self.add(seq[s:e])
        self.head = head
        self.sequence = seq
        self.original = {}

    def cleaner(self):
        for (header, sequence) in myReader.readFasta():
            clean = sequence.replace('-','').replace('_','')
            self.original[self.head] = clean
        return self.original

    def sites(self):
        Unique.cleaner(self)

I am calling on the sites function (which is why it runs cleaner as the first step), but I am lost on how I can go about writing code to find unique strings in each stored sequence.

As an example if I have 2 sets of Sequences:

1. UCGUUAGC
2. AGCGCAUU

The program would be able to tell me that the first sequence's unique string is UCG and the second's is AGC, since UCG is ONLY present in the first sequence and AGC is only present in the second.

EDIT: What I mean by unique sequence: Any strand of the sequence I can see and automatically know which sequence it came from. So if the strand UCGA only exists in one sequence, it is counted and saved as a unique strand associated with that sequence.

The sequences extracted look like this:

GAGAGAGACAUAGAGGDUAUGAPGPPGG'UUGAACCAAUAGUAGGGGGUPCG"UUCCUUCCUUUCUUACCA

Answer 1

So, if I understand correctly, you want all substrings of sequence A that do not exist in sequence B.

This can be easily achieved using a set complement or difference.

And I "stole" some code from another answer.

def get_all_substrings(input_string):
  length = len(input_string)
  return [input_string[i:j+1] for i in xrange(length) for j in xrange(i,length)]

# convert these to sets to remove duplicate substrings
seq1 = set(get_all_substrings('UCGUUAGC')) 
seq2 = set(get_all_substrings('AGCGCAUU'))

unique_seq1 = seq1 - seq2 # those sequences that are in seq1, and not in seq2
unique_seq2 = seq2 - seq1 # those sequences that are in seq2, and not in seq1

UPDATE: As pointed out in the comments, the get_all_substrings method I copied will eat away at memory for large strings, this version is more perfomant in that it lazily gets the next substring

def get_all_substrings(string):
    length = len(string)
    for i in xrange(length):
        for j in xrange(i + 1, length + 1):
            yield(string[i:j])