So I'm very new to HTML and I was trying to take an txt output file, convert it into usable data, and input that data into HTML, changing various attribute values, like title and innerHTML
As an example, I was trying to use document.GetElementById("vars").search to reference the sequence of dna stored in search and set it to some button's title, but it wound up being undefined.
I'm really just confused on how to use variables, and if you have any idea as to what format I should make the file of data input for the HTML please share!
<script id = "vars" type = "text/javascript">
      var seqId = "Chr23";
      var search = "CCATGCGAATGCTGATATCGTAGCAAAAACACAGGGACGGTGCGAAAGAAGAGGGATTTTATTTTGTTTTCGCCTGGCAATTGAGTAATGGCCGGACTCCTTCACCTGACCAAGCAGTGCAGCATCCACCTACCCGCCCACTTGGGACGCGCGAAATGCTACACACTCGCTAAGGGACCGGGAACACACGTGCAGGCAAGAGTG";
</script>