I'm working with DNA sequence alignments and trying to implement a simple scoring algorithm. Since i have to use a matrix for the calculations, i thought numpy should be way faster than a list of lists, but as I tested both, the python lists seem to be way faster. I found this thread (Why use numpy over list based on speed?) but still; i'm using preallocated numpy vs preallocated lists and list of lists are the clear winners. Here is my code:
Lists
def edirDistance(x, y):
    x_dim = len(x)+1
    y_dim = len(y)+1
    D = []
    for i in range(x_dim):
        D.append([0] * (y_dim))
    
    #Filling the matrix borders
    for i in range(x_dim):
        D[i][0] = i
    for i in range(y_dim):
        D[0][i] = i
    
    for i in range(1, x_dim):
        for j in range(1, y_dim):
            distHor = D[i][j-1] + 1
            distVer = D[i-1][j] + 1
            if x[i-1] == y[j-1]:
                distDiag = D[i-1][j-1]
            else:
                distDiag = D[i-1][j-1] + 1
            D[i][j] = min(distHor, distVer,distDiag)
    return D
Numpy
def NP_edirDistance(x, y):
    x_dim = len(x)+1
    y_dim = len(y)+1
    D = np.zeros((x_dim,y_dim))
    
    #Filling the matrix borders
    for i in range(x_dim):
        D[i][0] = i
    for i in range(y_dim):
        D[0][i] = i
    
    for i in range(1, x_dim):
        for j in range(1, y_dim):
            distHor = D[i][j-1] + 1
            distVer = D[i-1][j] + 1
            if x[i-1] == y[j-1]:
                distDiag = D[i-1][j-1]
            else:
                distDiag = D[i-1][j-1] + 1
            D[i][j] = min(distHor, distVer,distDiag)
    return D
I'm not timing the np import.
a = 'ACGTACGACTATCGACTAGCTACGAA'
b = 'ACCCACGTATAACGACTAGCTAGGGA'
%%time
edirDistance(a, b)
total: 1.41 ms
%%time
NP_edirDistance(a, b)
total: 4.43 ms
Replacing D[i][j] by D[i,j] greatly improved time, but still slower. (Thanks @Learning is a mess !)
total: 2.64 ms
I tested with even larger DNA sequences (around 10.000 letters each) and still lists are winning.
Can someone help me improve timing?
Are lists better for this use?