FASTA is a software package for sequence alignment of proteins and nucleic acids. FASTA is also the name of the file format used by these programs to represent sequences of peptides or nucleotides. The format is a de facto standard in bioinformatics.
The FASTA format (read as "fast A format") is a text-based format used by the FASTA software for representing nucleic acids and proteins. It represents each nucleotide and amino-acid as a letter. The FASTA format also supports naming of sequences.
The format achieved great popularity, becoming the de facto standard for representing biological sequences.
A bioinformatical record in FASTA format consists of the header (comment) string followed by one or more strings describing the sequence (one letter per nucleotide or amino acid). Header strings begin with >. The sequence that follows is wrapped at a fixed width (often 60, but generally no more than 80).
> Sample nucleotide sequence
AGCACTGAGTAACGTATAAGCAGTCCCCGGACGCGTA
> Nucleotide sequence #2
GCCACGGGAGTTGAAGAACATCGAGAATGCCACTAGTTTTCACCCTTCATAGATATCCTA
GCGCCGTACATGTATACGAGATCTTTGTCACGCAGTATGGAGGATTGTGGCCAGCAATAC
GTCGTGTCCCGCAATGCTTCATTAGATCCCCGTATATCCATCCTGAGTCATTGTCTGTTG
TCCGTTTTGAAGGAGTCTAGCAGCTTGATA